Journal: eLife

Article Title: An altered cell-specific subcellular distribution of translesion synthesis DNA polymerase kappa (POLK) in aging mouse neurons

doi: 10.7554/eLife.101533

Figure Lengend Snippet: ( A ) Protein sequence alignment of mouse and human POLK, with the 133–310 amino acid epitope for sc-166667 anti-POLK antibody showing complete homology between species. ( B ) qPCR of Polk transcript shows a 35% reduction upon siRNA against Polk but not scrambled control siRNA. Polh mRNA levels were not affected by siRNA against Polk. ( C ) Western blot immunostained with SC-166667 antiPOLK-HRP antibody of whole cell lysates of two biological replicates of mouse primary cortical neurons treated with four individual shPOLK lentivirus, shows a decrease in 99 and 120 kDa POLK bands upon treatment with shPOLK#C. ( D ) Western blot immunostained with SC-166667 antiPOLK-HRP antibody of whole cell lysates of two biological replicates of mouse Neuro-2A cells treated with either siPOLK or shPOLK lentivirus, showed a decrease in 99 kDa POLK band. ( E ) Western blot immunostained with SC-166667 antiPOLK-HRP antibody of whole cell lysates of three biological replicates of mouse 4T1 cells treated with siPOLK showed a decrease in 99 and 120 kDa POLK bands. ( F ) Immunofluorescence staining of wild-type 18-month-old mouse, from brain cortical area S1 shows a similar pattern and distribution of POLK nuclear speckles (arrowheads) and cytoplasmic granules (arrows) using sc-166667 and A12052. The bottom row is a crop of the boxed area in the corresponding top image. ( G ) Full western blot showing all six replicates nucleus and cytoplasmic fractions from 7- and 22-month-old whole brain unsorted cells. Quantitation of the 99 kDa POLK band did not show an increase, possibly due to inability to extract POLK associated with lysosomal and stress granules (as observed in ). ( H ) Representative low (×20) and high magnification (×63) images of REV1 and POLI expression using IF from S1 and M1 cortical regions in ages 1, 10, and 18 months. REV1 (green) and Nissl depicting all cells (purple) (scale bar = 10 µm in ×20 image). Arrowheads point to nuclear speckles and arrows indicate cytoplasmic granules. Wild-type mouse brain cortical areas S1 and M1 show REV1 and POLI punctate nuclear expression resembling speckles and progressive cytoplasmic accumulation with age at 10 and 18 months. Figure 1—figure supplement 1—source data 1. Annotated original blots corresponding to . Figure 1—figure supplement 1—source data 2. Raw scans of original blots to .

Article Snippet: In addition, N2a cells were transduced with lentiviral vectors expressing shPolk (Cat No. TL502663V, Origene, which have four unique 29mer target-specific shRNAs sequences are 5′ → 3′′, TL502663VA: AGCCATGCCAGGATTTATTGCTAAGAGGC , TL502663VB: CCAGGATTTATTGCTAAGAGGCTCTGCC , TL502663VC: AATCGCAGCAAAGAGGAATGTCCTGATAT , TL502663VD: GGAGCTGCTAAGGACAGAAGTTAATGTGG ) or scrambled shRNA (Cat No. TR30021V, Origene, sequences are 5′ → 3′′ GCACTACCAGAGCTAACTCAGATAGTACT ) for 8 hr, followed by replacement with complete media.

Techniques: Sequencing, Control, Western Blot, Immunofluorescence, Staining, Quantitation Assay, Expressing

Journal: International Journal of Molecular Sciences

Article Title: Unfolding Immune Dysregulation in COPD: Identification of a Three-Gene Signature and Functional Validation of TCF7 in Human Lung Tissue and T Lymphocytes

doi: 10.3390/ijms27104231

Figure Lengend Snippet: TCF7 regulates pro−caspase−8 expression in T lymphocytes and is significantly reduced in COPD. ( A ) Immunofluorescence co−staining of control human lung tissue displaying separate channels for DAPI (blue), caspase−8 (green), TCF7 (red), and the merged image. Scale bar is 50 μm. ( B ) Immunofluorescence co−staining of COPD human lung tissue displaying separate channels for DAPI (blue), caspase−8 (green), TCF7 (red), and the merged image. Note the marked reduction in both TCF7 and caspase−8 signals compared to the control. Scale bar is 50 μm. ( C ) Representative Western blot images of TCF7 (50 kDa), pro−caspase−8 (55 kDa), and internal control β−tubulin (55 kDa) in wild type (WT) and TCF7 knockout (KO) Jurkat T cells. ( D ) Quantitative densitometric analysis of TCF7 protein levels comparing WT and KO groups. ( E ) Quantitative densitometric analysis of pro−caspase−8 protein levels comparing WT and KO groups. ( F ) Representative Western blot images of TCF7 and β−tubulin in primary T lymphocytes isolated from the peripheral blood of healthy donors (Control) and patients with COPD (Model). ( G ) Quantitative densitometric analysis of TCF7 protein levels in human primary T lymphocytes. ( H ) Representative Western blot images of TCF7 and β−tubulin protein levels in Jurkat T cells across four experimental conditions including Control, shRNA, shRNA plus TCF7 Rescue construct, and shRNA plus Empty Vector. ( I ) Quantitative densitometric analysis of TCF7 protein levels across the four experimental rescue groups. ( J ) Representative Western blot images of pro−caspase−8 and β−tubulin protein levels across the same four experimental conditions in Jurkat T cells. ( K ) Quantitative densitometric analysis of pro−caspase−8 protein levels across the four experimental rescue groups. Data in the bar charts are presented as mean ± SD ( n = 4 for primary human cells, n = 3 for cell line experiments). Statistical significance was assessed using Student’s t test with Welch’s correction where appropriate (* p < 0.05, *** p < 0.001, ns indicates not significant).

Article Snippet: Short hairpin RNA targeting human TCF7 (shRNA) and a scramble control shRNA were purchased from OriGene with Cat.No.TR30004.

Techniques: Expressing, Immunofluorescence, Staining, Control, Western Blot, Knock-Out, Isolation, shRNA, Construct, Plasmid Preparation